Studio epidemiologico sulla correlazione tra insorgenza di glaucoma primario ad angolo aperto e presenza di polimorfismi dei genotipi Glutatione S-transferasi M1 e T1 nella popolazione di Palermo

Progetto: Research project

Dettagli progetto

Description

Il glaucoma primario ad angolo aperto rappresenta la forma più comune di glaucoma. Si tratta di una malattia complessa cronico-degenerativa con etiologia multifattoriale tra cui l’elevata pressione intraoculare, la familiarità, le alterazioni aterosclerotiche, dismetabolismi etc. Tale patologia,è caratterizzata da livelli aumentati di glutammato,con effetti tossici, e danno al DNA di tipo ossidativo a seguito di specie ossigeno-reattive (ROS). Le Glutatione S-transferasi (GST) sono una importante famiglia di enzimi metabolizzanti i farmaci di II fase. A causa del polimorfismo genetico dei GST, numerosi studi tendono a verificare se alcune varianti alleliche siano associate con il verificarsi o comunque con un aumentato rischio di patologie cronico-degenerative. Fra le classi di GSTs, i genotipi GSTM1, GSTM3, GSTT1, GSTP1 e GSTZ1 sono state ritrovati distribuiti polimorficamente. Alcuni studi hanno approfondito la eventualità di una correlazione esistente tra varianti polimorfiche del gene GST e suscettibilità a patologie oculari quali cataratta, degenerazione maculare senile e glaucoma.
Nel nostro studio epidemiologico abbiamo l’obiettivo di verificare la distribuzione dei polimorfismi GSTM1 e GSTT1 in pazienti affetti da glaucoma primario ad angolo aperto rispetto a un gruppo di controllo costituito da soggetti sani e valutare la possibile associazione tra le diverse varianti GST e l’incidenza di glaucoma primario ad angolo aperto.
Verranno reclutati 80 soggetti che afferiscono alla Sezione di Oftalmologia, dei quali 40 affetti da glaucoma primario ad angolo aperto e 40 sani, tutti di nazionalità italiana per evitare variabilità ti tipo razziale. La diagnosi di glaucoma primario ad angolo aperto viene definita clinicamente, mentre i controlli saranno reclutati tra coloro che si presentano con motivazioni diagnostiche diverse dal glaucoma, quali congiuntiviti, blefariti, prurito o presbiopia.
Da tutti i soggetti saranno effettuati prelievi venosi di sangue e il DNA genomico verrà estratto mediante NucleoSpin DNA purification kit.
I polimorfismi genetici GSTM1 e GSTT1 saranno valutati utilizzando la tecnica multiplex polymerase chain reaction (PCR). I soggetti con una o due copie dei geni rilevanti saranno classificati come genotipo “presente” e i soggetti con delezioni omozigote come genotipo “nullo”.
Le differenze emergenti nella distribuzione dei polimorfismi nei pazienti e nei controlli verranno analizzate statisticamente. Verranno inoltre calcolati gli odds ratio (OR) al fine di confrontare le frequenze del ritrovamento di genotipi GSTM1 e GSTT1 nei due gruppi.
I risultati dello studio potranno chiarire e confermare la possibilità che i polimorfismi del gene GST, in particolare i genotipi positivi GSTM1 e i genotipi nulli GSTT1, possano rappresentare un fattore di rischio genetico per l’insorgenza del glaucoma primario ad angolo aperto nella nostra popolazione italiana.

Layman's description

Nel nostro studio epidemiologico abbiamo l’obiettivo di verificare se la frequenza di genotipi positivi per Glutatione-S-Transferasi M1 (GSTM1) sia maggiore in maniera statisticamente significativa nei pazienti affetti da glaucoma rispetto al gruppo dei controlli. Inoltre, sarà possibile verificare se la frequenza del genotipo Glutatione-S-Transferasi T1 (GSTT1) “nullo” sia più elevata sempre nel gruppo dei pazienti affetti da glaucoma rispetto ai controlli. Successivamente, per entrambi i genotipi sarà possibile valutare gli odds ratio e quindi il rischio di sviluppare la patologia glaucomatosa ad angolo aperto sia per quei soggetti con genotipo GSTM1 positivo che per i soggetti con genotipo GSTT1 “nullo”.
I risultati dello studio potranno chiarire e confermare la possibilità che i polimorfismi del gene GST, in particolare i genotipi positivi GSTM1 e i genotipi nulli GSTT1, possano rappresentare un fattore di rischio genetico per l’insorgenza del glaucoma primario ad angolo aperto nella nostra popolazione italiana. In caso affermativo, sarà anche possibile valutare l’effetto combinato dei due polimorfismi nell’aumentare la suscettibilità alla patologia glaucomatosa.

Materiali e metodi
Verranno reclutati 80 soggetti, tutti di nazionalità italiana per evitare una variabilità di tipo razziale, che afferiscono alla Sezione di Oftalmologia del Dipartimento di Neuroscienze Cliniche. 40 soggetti saranno reclutati tra coloro con diagnosi di glaucoma primario ad angolo aperto e 40 soggetti controllo saranno reclutati appaiati per età tra coloro che si presentano con motivazioni diagnostiche diverse dal glaucoma, quali congiuntiviti, blefariti, prurito o presbiopia. Tutti i soggetti verranno sottoposti ad esame biomicroscopico e analisi del campo visivo. Tutti i soggetti che parteciperanno allo studio, oltre a vivere nella stessa città non dovranno avere un’anamnesi personale o familiare di glaucoma.
Da tutti i soggetti saranno effettuati prelievi venosi di sangue in provette da 5ml con EDTA. Il sangue intero verrà suddiviso in aliquote e conservato a -80°C fino al momento dell’analisi. Il DNA genomico verrà estratto dal sangue intero mediante NucleoSpin DNA purification kit (Macherey-Nagel GmbH, Duren, Germany) secondo le indicazioni d’uso.
I polimorfismi genetici GSTM1 e GSTT1 saranno valutati utilizzando la tecnica multiplex polymerase chain reaction (PCR). I primers da utilizzare per GSTM1 sono 5'-GAACTCCCTGAAAAGCTAAAGC e 5'-GTTGGGCTC AAATATACGGTGG, mentre per GSTT1 sono 5'-TTCCTTACTGGTCCTCA CATCTC e 5'-TCACCGGATCATGGCCAGCA. Il Locus betaglobina sarà utilizzato come controllo interno alla tecnica per evitare letture false negative. I primers per la betaglobina sono 5'- CAACTTCATCCACGTTCACC e 5'- GAAGAGCCAAGGACAGGTAC.
La reazione PCR sarà eseguita su un volume totale di 25 microlitri contenenti 10 pmol di ciascun primer, 2.5 mmol/L of MgCl2, 0.2 mmol/L di ciascun DNTP, 1 unità di Taq polimerasi e 100 ng di DNA genomico. L’amplificazione sarà condotta mediante iniziale denaturazione a 94°C per 5 min, seguita da 30 cicli a 94°C per 1 min, 64°C per 1 min e 72°C per 1 min, e una estensione finale di 72°C per 7 min. I prodotti amplificati verranno identificati tramite elettroforesi in gel agarosio 1.5% dopo colorazione con bromuro di etidio 0.5 microgr./ml. I soggetti con una o due copie dei geni rilevanti saranno classificati come genotipo “presente” e i soggetti con delezioni omozigote come genotipo “nullo”.
Le differenze nei polimorfismi tra i due gruppi di pazienti verranno analizzate statisticamente mediante opportuni tests con l’utilizzo del software statistico SPSS v.14.0 (SPSS Inc., Chicago, USA). Saranno considerate significative le differenze statistiche con p inferiore a 0.05. Verranno inoltre calcolati gli odds ratio (OR) e i relativi intervalli di confidenza (CI) al fine di confrontare le frequenze del ritrovamento di
StatoAttivo
Data di inizio/fine effettiva1/1/06 → …

Fingerprint

Esplora i temi di ricerca toccati da questo progetto. Queste etichette sono generate sulla base dei riconoscimenti/sovvenzioni sottostanti. Insieme formano una fingerprint unica.